si:dkey-27p1.2

Ensembl ID:
ENSDARG00000043757
ZFIN ID:
ZDB-GENE-091116-1
Human Orthologue:
ROD1
Human Description:
ROD1 regulator of differentiation 1 (S. pombe) [Source:HGNC Symbol;Acc:10253]
Mouse Orthologue:
Rod1
Mouse Description:
ROD1 regulator of differentiation 1 (S. pombe) Gene [Source:MGI Symbol;Acc:MGI:1923334]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2556 Essential Splice Site F2 line generated During 2018
sa5581 Essential Splice Site F2 line generated During 2018

Mutation Details

Allele Name:
sa2556
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040308 Essential Splice Site 208 522 5 13
ENSDART00000146727 Essential Splice Site 208 522 6 14
ENSDART00000040308 Essential Splice Site 208 522 5 13
ENSDART00000146727 Essential Splice Site 208 522 6 14
Genomic Location (Zv9):
Chromosome 10 (position 11140238)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 11216104
GRCz11 10 11174342
KASP Assay ID:
554-3066.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCCTTGCTACAATATGCAGATCCAATGAACGCACATCATGCCAAAGTGG[T/G]CAGTATCAACAAACAATCCATAACCACAAGATGCTCCTTTTAATAGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5581
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040308 Essential Splice Site 208 522 5 13
ENSDART00000146727 Essential Splice Site 208 522 6 14
ENSDART00000040308 Essential Splice Site 208 522 5 13
ENSDART00000146727 Essential Splice Site 208 522 6 14
Genomic Location (Zv9):
Chromosome 10 (position 11140238)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 11216104
GRCz11 10 11174342
KASP Assay ID:
554-3066.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCCTTGCTACAATATGCAGATCCAATGAACGCACATCATGCCAAAGTGG[T/G]CAGTATCAACAAACAATCCATAACCACAAGATGCTCCTTTTAATAGCAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link