
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-27p1.2
- Ensembl ID:
- ENSDARG00000043757
- ZFIN ID:
- ZDB-GENE-091116-1
- Human Orthologue:
- ROD1
- Human Description:
- ROD1 regulator of differentiation 1 (S. pombe) [Source:HGNC Symbol;Acc:10253]
- Mouse Orthologue:
- Rod1
- Mouse Description:
- ROD1 regulator of differentiation 1 (S. pombe) Gene [Source:MGI Symbol;Acc:MGI:1923334]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa2556 | Essential Splice Site | F2 line generated | During 2018 |
sa5581 | Essential Splice Site | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa2556
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000040308 | Essential Splice Site | 208 | 522 | 5 | 13 |
ENSDART00000146727 | Essential Splice Site | 208 | 522 | 6 | 14 |
ENSDART00000040308 | Essential Splice Site | 208 | 522 | 5 | 13 |
ENSDART00000146727 | Essential Splice Site | 208 | 522 | 6 | 14 |
- Genomic Location (Zv9):
- Chromosome 10 (position 11140238)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 11216104 GRCz11 10 11174342 - KASP Assay ID:
- 554-3066.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GGCCTTGCTACAATATGCAGATCCAATGAACGCACATCATGCCAAAGTGG[T/G]CAGTATCAACAAACAATCCATAACCACAAGATGCTCCTTTTAATAGCAGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa5581
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000040308 | Essential Splice Site | 208 | 522 | 5 | 13 |
ENSDART00000146727 | Essential Splice Site | 208 | 522 | 6 | 14 |
ENSDART00000040308 | Essential Splice Site | 208 | 522 | 5 | 13 |
ENSDART00000146727 | Essential Splice Site | 208 | 522 | 6 | 14 |
- Genomic Location (Zv9):
- Chromosome 10 (position 11140238)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 11216104 GRCz11 10 11174342 - KASP Assay ID:
- 554-3066.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GGCCTTGCTACAATATGCAGATCCAATGAACGCACATCATGCCAAAGTGG[T/G]CAGTATCAACAAACAATCCATAACCACAAGATGCTCCTTTTAATAGCAGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: