nrxn3a
- Ensembl ID:
- ENSDARG00000043746
- ZFIN IDs:
- ZDB-GENE-070206-9, ZDB-GENE-070206-9, ZDB-GENE-070206-9
- Description:
- neurexin 3a [Source:RefSeq peptide;Acc:NP_001073478]
- Human Orthologue:
- NRXN3
- Human Description:
- neurexin 3 [Source:HGNC Symbol;Acc:8010]
- Mouse Orthologue:
- Nrxn3
- Mouse Description:
- neurexin III Gene [Source:MGI Symbol;Acc:MGI:1096389]
Alleles
There are 10 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa2921 |
Nonsense |
F2 line generated |
During 2018 |
sa18056 |
Nonsense |
Available for shipment |
Available now |
sa14031 |
Nonsense |
Available for shipment |
Available now |
sa11330 |
Nonsense |
Available for shipment |
Available now |
sa36373 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa32142 |
Essential Splice Site |
Available for shipment |
Available now |
sa9245 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa36372 |
Essential Splice Site |
Available for shipment |
Available now |
sa36371 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa23034 |
Nonsense |
Available for shipment |
Available now |
Mutation Details
- Allele Name:
- sa2921
- Current Status:
-
F2 line generated
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 17 (position 17271478)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
17 |
17421489 |
GRCz11 |
17 |
17441325 |
- KASP Assay ID:
- 554-3195.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GGCCTGGAGTTTACAGGGTTGCAAGGCCAGTGGGCACGCTATCTCCGCTG[G/A]GACGCCAGCACCAGAAGTGACCTCAGCTTCCAGTTCAAAACAGACGTGTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18056
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 17 (position 17271147)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
17 |
17421158 |
GRCz11 |
17 |
17440994 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TGAGGCAGTACATGAAGATCGTTAGTGACCTCTTCCTGGGCGGAGTCCCT[C/T]AAGATATTCGCATTTCTGTGCTCACTCTCCCGACAGTGAAGGATCTTCCG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14031
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 17 (position 17270881)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
17 |
17420892 |
GRCz11 |
17 |
17440728 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- AAGACGGAATATGTTGGCCGATTCTGCAACGAAGGTAAATATATGGTTTA[T/A]ATATCAAAGCAGATACAGTGTAAAATCTTTAAATTTATTGGCAAAGGTCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11330
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 17 (position 17148445)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
17 |
17298456 |
GRCz11 |
17 |
17318292 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- CGCATTGTGGACCCCAAGATGAAGATMCAGGGCGATGTGGTGTTCAAGTG[T/A]GAAAACGTGGCAACGCTGGATCCRATTTCGTTCGAGACGCCTGAGGCCTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36373
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 17 (position 17143384)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
17 |
17293395 |
GRCz11 |
17 |
17313231 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTCAGGCAAACAGTGCGACAGTTACCCATGCAAAAACAAAGGCTTGTGC[A/T]AAGAAGGCTGGAATCGGTTTATCTGTGACTGCACAGGCACTGGTTACTGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32142
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 17 (position 17143314)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
17 |
17293325 |
GRCz11 |
17 |
17313161 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TATCTGTGACTGCACAGGCACTGGTTACTGGTCCCGCACCTGCGAGAGGG[G/A]TGAGTTCACTGATTTTACACTTACAAGCCTGGATTTATGGAGTTTGGGTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9245
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 17 (position 17103438)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
17 |
17253449 |
GRCz11 |
17 |
17273285 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- CGGAGGGGCAAAAGCTACAAGCTAACGGTTGAYGATGAMGTAGCAGAAGG[T/C]ACTATCCTTGGTCCTCAATCTGAAAGACAAGCACAATTCTTGATGGGTTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36372
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 17 (position 16960231)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
17 |
17110242 |
GRCz11 |
17 |
17130078 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCACCCATTTCCATATACCGCTCTCCAGCGTTTCTTAGAAGCGGACATGG[T/C]GAGTTTGCATGGAGTTGTACCATTTGAGAAGACTTGCTTGCTGTTAATTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36371
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 17 (position 16804161)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
17 |
16954989 |
GRCz11 |
17 |
16962922 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CATGTCTACCACCACCACCAGAAAACACCGCACCCCACCAACAATACAGG[T/C]AATGCACAACACACATGAAAAACACATGAGAGAAATGTGTGCTGAGATTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23034
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 17 (position 16768421)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
17 |
16919249 |
GRCz11 |
17 |
16927182 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTAGACCACGGATGACATGGTTTCGTCGGCCGAGTGTTCCAGTGACGAC[G/T]AGGACTTTGCGGAGTGCGAAGGACATGCAGGTGGGCTAGGTCAGTTCACT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: