zgc:103710

Ensembl ID:
ENSDARG00000043719
ZFIN IDs:
ZDB-GENE-041212-2, ZDB-GENE-041212-2
Description:
hypothetical protein LOC494039 [Source:RefSeq peptide;Acc:NP_001008582]
Human Orthologue:
C3
Human Description:
complement component 3 [Source:HGNC Symbol;Acc:1318]
Mouse Orthologue:
C3
Mouse Description:
complement component 3 Gene [Source:MGI Symbol;Acc:MGI:88227]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39714 Nonsense Mutation detected in F1 DNA During 2018
sa38301 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39714
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064202 Nonsense 67 461 2 12
ENSDART00000075469 Nonsense 67 320 2 11
Genomic Location (Zv9):
Chromosome 1 (position 56623800)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 55407837
GRCz11 1 56077198
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAAGCTTAATCGTGAAGATCTCTGTAAAGAACCACCCGAGGAAGAACT[T/A]GGAGATCCTGTCGAAAACAGTAACACTGACCGACGAAAACAATTTCCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38301
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064202 Essential Splice Site 170 461 4 12
ENSDART00000075469 Essential Splice Site 170 320 4 11
Genomic Location (Zv9):
Chromosome 1 (position 56623215)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 55407252
GRCz11 1 56076613
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTGGTCTGAAGCCACTTGAAAATGCTGGAGTATCAGTGGAAATCATG[G/A]TAATCTTACTAAAATCCACTTAAACCTTCCTAGACAGTGACATTATGGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link