vstm2l

Ensembl ID:
ENSDARG00000043692
ZFIN ID:
ZDB-GENE-040426-1548
Description:
V-set and transmembrane domain containing 2 like [Source:RefSeq peptide;Acc:NP_956790]
Human Orthologue:
VSTM2L
Human Description:
V-set and transmembrane domain containing 2 like [Source:HGNC Symbol;Acc:16096]
Mouse Orthologue:
Vstm2l
Mouse Description:
V-set and transmembrane domain containing 2-like Gene [Source:MGI Symbol;Acc:MGI:2685537]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24752 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24752
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064157 Nonsense 11 187 1 4
Genomic Location (Zv9):
Chromosome Zv9_scaffold3522 (position 53560)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 2000012
GRCz11 6 2133678
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAGAGCATAGAGCAGAAATGGGCTCGTTTGGAGGGATGTTTTGGATTT[T/A]ACACTGGATAGCACTTTATGTCCAGATCAGCTCGAAACTGGCAGTGGATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link