zgc:100997

Ensembl ID:
ENSDARG00000043667
ZFIN ID:
ZDB-GENE-040801-124
Description:
hypothetical protein LOC445211 [Source:RefSeq peptide;Acc:NP_001003605]
Human Orthologue:
CLMN
Human Description:
calmin (calponin-like, transmembrane) [Source:HGNC Symbol;Acc:19972]
Mouse Orthologue:
Clmn
Mouse Description:
calmin Gene [Source:MGI Symbol;Acc:MGI:2136957]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23646 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23646
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064114 Nonsense 169 687 6 10
ENSDART00000145140 Nonsense 147 271 5 7
Genomic Location (Zv9):
Chromosome 20 (position 10689269)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 10514943
GRCz11 20 10502183
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGTCATTACCATGTGACAGTGATTCTTCAGGTCGTAGTTCTCCAGCAT[C/A]ACCCGGAGATGACATTTTTGGCACTTTACCCTCAAAAGGCAAAAAGTCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link