vkorc1l1

Ensembl ID:
ENSDARG00000043644
ZFIN ID:
ZDB-GENE-050522-210
Description:
vitamin K epoxide reductase complex subunit 1-like protein 1 [Source:RefSeq peptide;Acc:NP_00101852
Mouse Orthologue:
Vkorc1l1
Mouse Description:
vitamin K epoxide reductase complex, subunit 1-like 1 Gene [Source:MGI Symbol;Acc:MGI:1916818]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12683 Nonsense Available for shipment Available now
sa40349 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa12683
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064088 Nonsense 27 175 1 3
ENSDART00000137721   None 139 1 3
Genomic Location (Zv9):
Chromosome 5 (position 2112261)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 1737608
GRCz11 5 2002933
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCTCGCTGGGAGCGGATAGYCCGGCTGCTCGTGTGTCTCTCAGGAATTT[T/A]GTTATCCCTGTATTCATTCCATGTGGAGAGGGAAAAAACCCGAGACGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40349
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064088 Essential Splice Site 64 175 1 3
ENSDART00000137721   None 139 1 3
Genomic Location (Zv9):
Chromosome 5 (position 2112373)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 1737720
GRCz11 5 2003045
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTGCGACCTGAGCAGCTCCATCAGCTGCTCCAAAGTCTTCACGTCCAG[G/A]TGAGAAAGCTTGCGGCTACGTGTCAAAACCTGTCGCGTTCCCTTCATAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link