
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
vkorc1l1
- Ensembl ID:
- ENSDARG00000043644
- ZFIN ID:
- ZDB-GENE-050522-210
- Description:
- vitamin K epoxide reductase complex subunit 1-like protein 1 [Source:RefSeq peptide;Acc:NP_00101852
- Mouse Orthologue:
- Vkorc1l1
- Mouse Description:
- vitamin K epoxide reductase complex, subunit 1-like 1 Gene [Source:MGI Symbol;Acc:MGI:1916818]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa12683 | Nonsense | Available for shipment | Available now |
sa40349 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa12683
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000064088 | Nonsense | 27 | 175 | 1 | 3 |
ENSDART00000137721 | None | 139 | 1 | 3 |
- Genomic Location (Zv9):
- Chromosome 5 (position 2112261)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 1737608 GRCz11 5 2002933 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CCCTCGCTGGGAGCGGATAGYCCGGCTGCTCGTGTGTCTCTCAGGAATTT[T/A]GTTATCCCTGTATTCATTCCATGTGGAGAGGGAAAAAACCCGAGACGCCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa40349
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000064088 | Essential Splice Site | 64 | 175 | 1 | 3 |
ENSDART00000137721 | None | 139 | 1 | 3 |
- Genomic Location (Zv9):
- Chromosome 5 (position 2112373)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 1737720 GRCz11 5 2003045 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATGTGCGACCTGAGCAGCTCCATCAGCTGCTCCAAAGTCTTCACGTCCAG[G/A]TGAGAAAGCTTGCGGCTACGTGTCAAAACCTGTCGCGTTCCCTTCATAAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: