tom1

Ensembl ID:
ENSDARG00000043638
ZFIN IDs:
ZDB-GENE-060721-1, ZDB-GENE-060721-1
Description:
Tom1 protein [Source:UniProtKB/TrEMBL;Acc:Q6DBV5]
Human Orthologue:
TOM1
Human Description:
target of myb1 (chicken) [Source:HGNC Symbol;Acc:11982]
Mouse Orthologues:
Gm5884, Tom1
Mouse Descriptions:
predicted pseudogene 5884 Pseudogene [Source:MGI Symbol;Acc:MGI:3644646]
target of myb1 homolog (chicken) Gene [Source:MGI Symbol;Acc:MGI:1338026]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40070 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40070
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064078 Essential Splice Site 378 409 13 14
ENSDART00000078179 Essential Splice Site 355 386 12 13
Genomic Location (Zv9):
Chromosome 3 (position 27099665)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 25804571
GRCz11 3 25935442
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTCATTTGTGATGCAGGAGGATGACTCTGAGGGAGTGACTAGTGAAG[G/A]TACTCTTCCTCTTCTGTTTCTGTTGTGTTGATGCTTTCTTCTGCAAATTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link