
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
elof1
- Ensembl ID:
- ENSDARG00000043601
- ZFIN ID:
- ZDB-GENE-040426-1385
- Description:
- transcription elongation factor 1 homolog [Source:RefSeq peptide;Acc:NP_956680]
- Human Orthologue:
- ELOF1
- Human Description:
- elongation factor 1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:28691]
- Mouse Orthologues:
- AC127331.1, AC127331.2, Elof1, Gm10525, Gm10526, Gm10527, Gm10528
- Mouse Descriptions:
- elongation factor 1 homolog (ELF1, S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1913376]
- predicted gene 10525 Gene [Source:MGI Symbol;Acc:MGI:3641771]
- predicted gene 10526 Gene [Source:MGI Symbol;Acc:MGI:3641768]
- predicted gene 10527 Gene [Source:MGI Symbol;Acc:MGI:3641767]
- predicted gene 10528 Gene [Source:MGI Symbol;Acc:MGI:3642526]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa11344 | Splice Site, Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa11344
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Splice Site, Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000064025 | Splice Site, Nonsense | 63 | 83 | 4 | 4 |
- Genomic Location (Zv9):
- Chromosome 3 (position 13607147)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 14347477 GRCz11 3 14497277 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGCTTGATGTCTAATGTTGTTGTGTTTTTGTCCTYAACTTAMCTGCCAGA[T/A]CTCTCGGAGCCGGTGGAYGTGTACAGCGATTGGATAGATGCTTGTGAAGC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: