zgc:103670

Ensembl ID:
ENSDARG00000043571
ZFIN IDs:
ZDB-GENE-040912-111, ZDB-GENE-040912-111
Description:
hypothetical protein LOC447926 [Source:RefSeq peptide;Acc:NP_001004664]
Human Orthologues:
KIF2A, KIF2B
Human Descriptions:
kinesin family member 2B [Source:HGNC Symbol;Acc:29443]
kinesin heavy chain member 2A [Source:HGNC Symbol;Acc:6318]
Mouse Orthologues:
Kif2a, Kif2b
Mouse Descriptions:
kinesin family member 2A Gene [Source:MGI Symbol;Acc:MGI:108390]
kinesin family member 2B Gene [Source:MGI Symbol;Acc:MGI:1920720]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27143 Nonsense Mutation detected in F1 DNA During 2018
sa21217 Nonsense Available for shipment Available now
sa34339 Nonsense Mutation detected in F1 DNA During 2018
sa34340 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa27143
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063976 Nonsense 98 143 5 6
ENSDART00000085377   None 704 None 22
ENSDART00000115405 Nonsense 98 143 5 6
Genomic Location (Zv9):
Chromosome 8 (position 13449321)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 12895015
GRCz11 8 12932720
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTTTGTTTTACAGTGGGCTCGACTCGGGCACGGCCAGCCCAACAACTA[C/T]AACAACAGCAGCAGCAGCAGCCACAGCCGCAGCCAGAATCAGCACCCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21217
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063976 Nonsense 118 143 5 6
ENSDART00000085377 Nonsense 123 704 6 22
ENSDART00000115405 Nonsense 118 143 5 6
Genomic Location (Zv9):
Chromosome 8 (position 13449381)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 12895075
GRCz11 8 12932780
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGCAGCAGCCACAGCCGCAGCCAGAATCAGCACCCCCTCCACCAGCA[C/T]AACAACCCTCTCAGCCCACACAGAGCCAGACCCAAAGCCAGCTAACTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34339
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063976   None 143 None 6
ENSDART00000085377 Nonsense 676 704 21 22
ENSDART00000115405   None 143 None 6
Genomic Location (Zv9):
Chromosome 8 (position 13463946)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 12909635
GRCz11 8 12947340
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAGCTTGAGCAAATTCTTGACCAGAAGATCGAGATCCTCATTGAACTC[C/T]GAGGTAAATGCTGAGAATGCTCTTTTACTTTTTTAATGTTCTCCCAATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34340
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063976   None 143 None 6
ENSDART00000085377 Nonsense 691 704 22 22
ENSDART00000115405   None 143 None 6
Genomic Location (Zv9):
Chromosome 8 (position 13464081)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 12909770
GRCz11 8 12947475
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTATCAGATAAAGTGAGGTCATTCCGTTCTGCACTTCAAGAGGAGGAA[C/T]AAGCCAGCAAGCAGATTAACCCCAAGCGGCCCCGTGCGCTGTAGCCTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link