si:dkey-22a1.3

Ensembl ID:
ENSDARG00000043566
ZFIN ID:
ZDB-GENE-030131-5651
Description:
Uncharacterized protein C3orf17 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q567G6]
Human Orthologue:
C3orf17
Human Description:
chromosome 3 open reading frame 17 [Source:HGNC Symbol;Acc:24496]
Mouse Orthologue:
BC027231
Mouse Description:
cDNA sequence BC027231 Gene [Source:MGI Symbol;Acc:MGI:2384836]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41431 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41431
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063961 Nonsense 78 528 2 9
ENSDART00000135221 Nonsense 86 536 2 9

The following transcripts of ENSDARG00000043566 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 28424215)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 27579911
GRCz11 9 27390657
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTTACATTTTGAACAATGGCTTCAGACAACACAAGCCATTCCGTGCAT[T/A]AAAGCAGGTGAGAGCCAGTCCTGTAATACACACACACACAGGTCAAAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link