
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-22a1.3
- Ensembl ID:
- ENSDARG00000043566
- ZFIN ID:
- ZDB-GENE-030131-5651
- Description:
- Uncharacterized protein C3orf17 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q567G6]
- Human Orthologue:
- C3orf17
- Human Description:
- chromosome 3 open reading frame 17 [Source:HGNC Symbol;Acc:24496]
- Mouse Orthologue:
- BC027231
- Mouse Description:
- cDNA sequence BC027231 Gene [Source:MGI Symbol;Acc:MGI:2384836]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa41431 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa41431
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000063961 | Nonsense | 78 | 528 | 2 | 9 |
ENSDART00000135221 | Nonsense | 86 | 536 | 2 | 9 |
The following transcripts of ENSDARG00000043566 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 9 (position 28424215)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 27579911 GRCz11 9 27390657 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCTTTACATTTTGAACAATGGCTTCAGACAACACAAGCCATTCCGTGCAT[T/A]AAAGCAGGTGAGAGCCAGTCCTGTAATACACACACACACAGGTCAAAAAC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: