zgc:65997

Ensembl ID:
ENSDARG00000043562
ZFIN ID:
ZDB-GENE-040426-1502
Description:
hypothetical protein LOC794398 [Source:RefSeq peptide;Acc:NP_956847]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42924 Nonsense Mutation detected in F1 DNA During 2018
sa23075 Nonsense Available for shipment Available now
sa42925 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42924
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063953 Nonsense 114 262 2 3
Genomic Location (Zv9):
Chromosome 17 (position 23379455)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23529604
GRCz11 17 23549628
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTAAAAAATGTCACTTGTGCTATTTTTTTACAGGGTGTCATTTCTACTT[T/A]GACCACTAATACGGTGGGTCCACTGGTGATGGCCAAGTATTTTGCCCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23075
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063953 Nonsense 170 262 3 3
Genomic Location (Zv9):
Chromosome 17 (position 23381214)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23531363
GRCz11 17 23551387
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTTTTTTTGTCTTAACATTTGTGTTATGTACTTTTTTCTTCAGCTCTT[G/T]GAGGCTGGTACAGCTATAGGATGTCTAAAGCCGCCTTAAACATGGCCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42925
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063953 Nonsense 172 262 3 3
Genomic Location (Zv9):
Chromosome 17 (position 23381222)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23531371
GRCz11 17 23551395
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTCTTAACATTTGTGTTATGTACTTTTTTCTTCAGCTCTTGGAGGCTG[G/A]TACAGCTATAGGATGTCTAAAGCCGCCTTAAACATGGCCACCAGAAACCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link