zgc:77655

Ensembl ID:
ENSDARG00000043555
ZFIN ID:
ZDB-GENE-030131-5884
Description:
transmembrane protein 30A [Source:RefSeq peptide;Acc:NP_991123]
Human Orthologue:
TMEM30A
Human Description:
transmembrane protein 30A [Source:HGNC Symbol;Acc:16667]
Mouse Orthologue:
Tmem30a
Mouse Description:
transmembrane protein 30A Gene [Source:MGI Symbol;Acc:MGI:106402]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23661 Missense Available for shipment Available now

Mutation Details

Allele Name:
sa23661
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063944 Missense 193 369 5 7
Genomic Location (Zv9):
Chromosome 20 (position 16693438)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 16753391
GRCz11 20 16652974
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATAATGAAATCTTTGCTCCTTCTCTCCACTTCAGATACGTTGGACCTG[T/A]TTTACATTGACCCCAATGGAACAAAAACCCAAATTCCGATGATCAAAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link