znf259

Ensembl ID:
ENSDARG00000043542
ZFIN ID:
ZDB-GENE-040426-2110
Description:
zinc finger protein ZPR1 [Source:RefSeq peptide;Acc:NP_998273]
Human Orthologue:
ZNF259
Human Description:
zinc finger protein 259 [Source:HGNC Symbol;Acc:13051]
Mouse Orthologue:
Zfp259
Mouse Description:
zinc finger protein 259 Gene [Source:MGI Symbol;Acc:MGI:1330262]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27628 Nonsense Mutation detected in F1 DNA During 2018
sa14665 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa27628
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063923 Nonsense 222 441 7 13
ENSDART00000100015 Nonsense 55 183 2 8
ENSDART00000131418 Nonsense 56 184 2 5
ENSDART00000136264   None 153 None 4
Genomic Location (Zv9):
Chromosome 10 (position 30733901)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 29939804
GRCz11 10 29826144
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAAAATCTGTTTCTTTAATCATCTCTTTTATTTTAGGTTGAAGAAGAA[C/T]AAGCAGATGAGAGTCCTGGCAATGATCTAGACACCCTGAGGAATGAGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14665
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063923 Nonsense 320 441 10 13
ENSDART00000100015 Nonsense 153 183 5 8
ENSDART00000131418 Nonsense 154 184 5 5
ENSDART00000136264   None 153 None 4
Genomic Location (Zv9):
Chromosome 10 (position 30732078)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 29937981
GRCz11 10 29824321
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAACTCATCATTAGGATGTGTGTGTTGCAGTCAGAGACATGCAGTGTGT[T/A]GATTCCCGAGCTGGAGTTTGAGTTGGGAATGGCGGCTCTCGGAGGGAAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link