zgc:55886

Ensembl ID:
ENSDARG00000043484
ZFIN ID:
ZDB-GENE-040426-831
Description:
zgc:55886 (zgc:55886), mRNA [Source:RefSeq DNA;Acc:NM_200959]
Human Orthologue:
UBE2D2
Human Description:
ubiquitin-conjugating enzyme E2D 2 (UBC4/5 homolog, yeast) [Source:HGNC Symbol;Acc:12475]
Mouse Orthologues:
1700013N18Rik, 4930524E20Rik, Gm9762, Ube2d2, Ube2dnl
Mouse Descriptions:
predicted pseudogene 9762 Pseudogene [Source:MGI Symbol;Acc:MGI:3704220]
RIKEN cDNA 1700013N18 gene Gene [Source:MGI Symbol;Acc:MGI:1920568]
RIKEN cDNA 4930524E20 gene Gene [Source:MGI Symbol;Acc:MGI:1922347]
ubiquitin-conjugating enzyme E2D 2 Gene [Source:MGI Symbol;Acc:MGI:1930715]
ubiquitin-conjugating enzyme E2D N-terminal like Gene [Source:MGI Symbol;Acc:MGI:3646570]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15846 Nonsense Available for shipment Available now
sa1274 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15846
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063837 Nonsense 45 118 3 5
Genomic Location (Zv9):
Chromosome 14 (position 7866403)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 7590030
GRCz11 14 7896249
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATANTTTTTGTCTACTAATTCCTCAGGTTGCATTTACCAYAAGAATTTA[T/A]CACCCAAATATCAACAGCAATGGCAGCATCTGTTTGGATATTCTGAGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1274
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063837 Nonsense 116 118 5 5
Genomic Location (Zv9):
Chromosome 14 (position 7870337)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 7593964
GRCz11 14 7900078
KASP Assay ID:
554-1189.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTTCCCTTACAGGTACAACAGAATAGCTCGGGAATGGACACAAAAGTA[T/A]GCAATGTAGTTTTGGAGATAAAAATCATGATGTGAGAATTACACCTCTCC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link