zgc:86586

Ensembl ID:
ENSDARG00000043482
ZFIN ID:
ZDB-GENE-040625-129
Description:
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3-like [Source:RefSeq peptide;Acc:NP_00
Human Orthologues:
B3GNT3, B3GNT6
Human Descriptions:
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3 [Source:HGNC Symbol;Acc:13528]
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase) [Source:HGNC Symbol;
Mouse Orthologues:
B3gnt3, B3gnt6
Mouse Descriptions:
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3 Gene [Source:MGI Symbol;Acc:MGI:215253
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase) Gene [Source:MGI Sym

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41142 Nonsense Mutation detected in F1 DNA During 2018
sa13454 Nonsense Available for shipment Available now
sa7610 Missense Mutation detected in F1 DNA During 2018
sa41141 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41142
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063834 Nonsense 148 390 2 2
Genomic Location (Zv9):
Chromosome 8 (position 14052231)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 13497575
GRCz11 8 13535280
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCGGAAAACATGGGCTGAAGAGAGATTGCACAAAGGTGTGTGGATCCGT[C/T]GAGTCTTTATAATCGGTACAAGTAGAAGTGGCTTTGAGAAACACAGGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13454
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063834 Nonsense 156 390 2 2
Genomic Location (Zv9):
Chromosome 8 (position 14052207)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 13497551
GRCz11 8 13535256
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAYTGCACAAAGGKGTGTGGATCCRTCGAGTCTTTATAATCGGTACAAGT[A/T]RAAGTGGCTTTGAGAAWCRCAGGCTGAATAGGCTACTGAAGCTRGAGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7610
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063834 Missense 228 390 2 2
Genomic Location (Zv9):
Chromosome 8 (position 14051990)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 13497334
GRCz11 8 13535039
KASP Assay ID:
554-4163.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTAGATGGAGATGATGACATTTTTGCCAATACRTTTAACATGATCGAGT[A/G]TCTTCAGGGTCAAGAAGACAATKATGGAAGTAGACATCTCTTTACTGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41141
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063834 Nonsense 255 390 2 2
Genomic Location (Zv9):
Chromosome 8 (position 14051910)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 13497254
GRCz11 8 13534959
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAGACATCTCTTTACTGGGCACCTTTTGCAGAAAGTAAAGCCTATAAGA[A/T]AGCTTTCAAGTAAATACTATGTCCCAGTTCAGATACACGAGTCTAACAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Tumor biomarkers: A genome wide association study of genetic loci that influence tumour biomarkers cancer antigen 19-9, carcinoembryonic antigen and α fetoprotein and their associations with cancer risk. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link