si:dkey-30h14.3

Ensembl ID:
ENSDARG00000043479
ZFIN ID:
ZDB-GENE-040724-51
Description:
Novel protein similar to vertebrate opsin 5 (OPN5) [Source:UniProtKB/TrEMBL;Acc:Q5TZG0]
Human Orthologue:
OPN5
Human Description:
opsin 5 [Source:HGNC Symbol;Acc:19992]
Mouse Orthologue:
Opn5
Mouse Description:
opsin 5 Gene [Source:MGI Symbol;Acc:MGI:2662912]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36990 Essential Splice Site Mutation detected in F1 DNA During 2018
sa13917 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36990
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063831 Essential Splice Site 18 304 1 5
ENSDART00000133529   None 175 None 2
Genomic Location (Zv9):
Chromosome 20 (position 13680705)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 13869951
GRCz11 20 13765931
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGAAAATTATGTTTATGTAGTGCAACTGTGTGGGCTTTTCAAGCCAAA[A/C]TAAATAAGGAACATCTTAGATCTGTTTCTTTGCTTTAGTCTTTTTTTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13917
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063831 Nonsense 40 304 2 5
ENSDART00000133529 Nonsense 14 175 1 2
Genomic Location (Zv9):
Chromosome 20 (position 13680482)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 13869728
GRCz11 20 13765708
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGTGATACTGTCAGTTCTGGGGAATGGAGTCRTGTTGGTCATCTCGTA[T/A]CGCCGCAGGAAGAAGATAGCCGGYTCAGAGCTGCTGTGTGTCAATTTGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link