
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
tagap
- Ensembl ID:
- ENSDARG00000043475
- ZFIN ID:
- ZDB-GENE-040724-50
- Description:
- T-cell activation GTPase activating protein [Source:RefSeq peptide;Acc:NP_001004548]
- Human Orthologue:
- TAGAP
- Human Description:
- T-cell activation RhoGTPase activating protein [Source:HGNC Symbol;Acc:15669]
- Mouse Orthologues:
- CT485609.2, Tagap, Tagap1
- Mouse Descriptions:
- T-cell activation GTPase activating protein 1 Gene [Source:MGI Symbol;Acc:MGI:1919786]
- T-cell activation Rho GTPase-activating protein Gene [Source:MGI Symbol;Acc:MGI:3615484]
- T-cell activation Rho GTPase-activating protein [Source:UniProtKB/Swiss-Prot;Acc:B2RWW0]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa23651 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa17749 | Nonsense | Available for shipment | Available now |
sa43398 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa1810 | Missense | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa23651
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000063826 | None | 687 | 1 | 10 | |
ENSDART00000127654 | Nonsense | 164 | 876 | 5 | 14 |
- Genomic Location (Zv9):
- Chromosome 20 (position 13575276)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 13764522 GRCz11 20 13660502 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGCCATGCTTTTTTCTGCATTGCAGCTTGCCTGAGCTGAGGGATCACTG[G/A]TTACAGACTTTACACAGGTGAGCACTCGTTTACAACTCTAACGTTTACTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa17749
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000063826 | None | 687 | 2 | 10 | |
ENSDART00000127654 | Nonsense | 171 | 876 | 6 | 14 |
- Genomic Location (Zv9):
- Chromosome 20 (position 13574707)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 13763953 GRCz11 20 13659933 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTNACAGTAGTTGCAGAACTGAAATTTTGCAATTTGAAATGTGGWGACAGG[A/T]AAACTGTGGAGGCAAGGTTGTTAGCGGGCAGCACTTCCCCACCCCCCAGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa43398
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000063826 | None | 687 | 2 | 10 | |
ENSDART00000127654 | Nonsense | 178 | 876 | 6 | 14 |
- Genomic Location (Zv9):
- Chromosome 20 (position 13574685)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 13763931 GRCz11 20 13659911 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATTTTGCAATTTGAAATGTGGTGACAGGAAAACTGTGGAGGCAAGGTTGT[T/A]AGCGGGCAGCACTTCCCCACCCCCCAGCGTCCTCATGAAGGTGCTGAGCG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa1810
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Missense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000063826 | Missense | 293 | 687 | 10 | 10 |
ENSDART00000127654 | Missense | 482 | 876 | 14 | 14 |
- Genomic Location (Zv9):
- Chromosome 20 (position 13565682)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 13754928 GRCz11 20 13650908 - KASP Assay ID:
- 554-1802.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CCCAGACCTTTAACGCCTAAATTATTCTACACAGATTCAGCCTCCTTGAT[G/A]TCCCCTGATATATCTTTCGAAGTCCACCAACATGACTCTGCATACGACAG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Celiac disease: Multiple common variants for celiac disease influencing immune gene expression. (View Study)
- Celiac disease: Newly identified genetic risk variants for celiac disease related to the immune response. (View Study)
- Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)
- Crohn's disease and celiac disease: A meta-analysis of genome-wide association scans identifies IL18RAP, PTPN2, TAGAP, and PUS10 as shared risk loci for Crohn's disease and celiac disease. (View Study)
- Multiple sclerosis: Genetic risk and a primary role for cell-mediated immune mechanisms in multiple sclerosis. (View Study)
- Multiple sclerosis: Genome-wide meta-analysis identifies novel multiple sclerosis susceptibility loci. (View Study)
- Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: