wu:fj39g12

Ensembl ID:
ENSDARG00000043460
ZFIN ID:
ZDB-GENE-030131-7901
Description:
natriuretic peptide precursor C-like protein [Source:RefSeq peptide;Acc:NP_001154813]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22799 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22799
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063804 Nonsense 97 132 3 3
ENSDART00000128163 Nonsense 97 132 2 2
Genomic Location (Zv9):
Chromosome 16 (position 19266154)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17296477
GRCz11 16 17204454
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATACCGGTGCAGAATGAGAATGCCTGGCTCCGGCTTTTAAAGGGGGCTT[T/A]GGCCAATCAGAAACGAGCTCCACCGGATCGGTTGCGGAGGGGGTGGAACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link