si:dkeyp-72h1.2

Ensembl ID:
ENSDARG00000043416
ZFIN ID:
ZDB-GENE-041210-301
Description:
tumor necrosis factor, alpha-induced protein 2 [Source:RefSeq peptide;Acc:NP_001025387]
Human Orthologue:
TNFAIP2
Human Description:
tumor necrosis factor, alpha-induced protein 2 [Source:HGNC Symbol;Acc:11895]
Mouse Orthologue:
Tnfaip2
Mouse Description:
tumor necrosis factor, alpha-induced protein 2 Gene [Source:MGI Symbol;Acc:MGI:104960]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32285 Nonsense Available for shipment Available now
sa23665 Nonsense Available for shipment Available now
sa13685 Essential Splice Site Available for shipment Available now
sa13324 Nonsense Available for shipment Available now
sa36998 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32285
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063736 Nonsense 321 547 4 13
ENSDART00000126959 Nonsense 321 701 4 13

The following transcripts of ENSDARG00000043416 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 18745352)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 18773609
GRCz11 20 18673192
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACTGCAAGAGCTTACCAGGTCCAGTATTGAGTTTGAGGATTGCGCCTA[T/A]ATACTGAGCTGGATAAAGATCTACTACCCAAAGTAAGATTGATGTCTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23665
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063736 Nonsense 361 547 5 13
ENSDART00000126959 Nonsense 361 701 5 13

The following transcripts of ENSDARG00000043416 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 18749580)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 18777837
GRCz11 20 18677420
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACAGTTCATTACTTGGACCTCTGTTACCTGAGGAACATCTTAAAAGAT[T/A]AGAGGATCAGTACTTCTCATGCAAGGAGGTAATTTTATCAAAGTCATTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13685
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063736 Essential Splice Site 370 547 5 13
ENSDART00000126959 Essential Splice Site 370 701 5 13

The following transcripts of ENSDARG00000043416 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 18749610)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 18777867
GRCz11 20 18677450
KASP Assay ID:
2261-4118.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGGAACATCTTAAAAGATTAGAGGATCAGTACTTCTCATGCAAGGAGG[T/A]AATTTTWTCAAAGTCATTACCAAATAGTTTTATCANNAGTCAACCTCAWA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13324
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063736 Nonsense 400 547 6 13
ENSDART00000126959 Nonsense 400 701 6 13

The following transcripts of ENSDARG00000043416 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 18749862)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 18778119
GRCz11 20 18677702
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGTGGATAAATGGAGTGATGGCTTTGAACCTGAGCTCATTGAAGGATG[C/A]TACTTTGGTAACCTTGCTGTCGATRTTTTRCCGGTAAGCTATGGGCTMTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36998
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063736 Essential Splice Site 411 547 6 13
ENSDART00000126959 Essential Splice Site 411 701 6 13

The following transcripts of ENSDARG00000043416 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 18749897)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 18778154
GRCz11 20 18677737
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCATTGAAGGATGCTACTTTGGTAACCTTGCTGTCGATGTTTTGCCGG[T/A]AAGCTATGGGCTCTGTTGACATGCTATGCAGTATGTATTAAAAATATACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link