zgc:112231

Ensembl ID:
ENSDARG00000043360
ZFIN ID:
ZDB-GENE-050522-545
Description:
DPH3 homolog [Source:RefSeq peptide;Acc:NP_001153296]
Human Orthologue:
DPH3
Human Description:
DPH3, KTI11 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:27717]
Mouse Orthologues:
Dph3, Dph3b-ps
Mouse Descriptions:
DPH3 homolog (KTI11, S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1922658]
DPH3B, KTI11 homolog B (S. cerevisiae), pseudogene Pseudogene [Source:MGI Symbol;Acc:MGI:3647154]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30624 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30624
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063644 Essential Splice Site 61 85 2 3
Genomic Location (Zv9):
Chromosome 6 (position 15027933)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 15001165
GRCz11 6 15128105
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCACCTGTCCAAGCTGTTCGCTAATAGTAAAAGTAATTTATGATAAGG[T/C]AAGGTCAACATGACAATATTCATTTATACATGTGTATTTTCTTGACTTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link