zgc:56388

Ensembl ID:
ENSDARG00000043301
ZFIN ID:
ZDB-GENE-040426-1009
Description:
general transcription factor 3C polypeptide 6 [Source:RefSeq peptide;Acc:NP_956556]
Human Orthologue:
GTF3C6
Human Description:
general transcription factor IIIC, polypeptide 6, alpha 35kDa [Source:HGNC Symbol;Acc:20872]
Mouse Orthologue:
Gtf3c6
Mouse Description:
general transcription factor IIIC, polypeptide 6, alpha Gene [Source:MGI Symbol;Acc:MGI:1914621]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36090 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36090
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063572 Nonsense 17 183 1 1
Genomic Location (Zv9):
Chromosome 16 (position 19314380)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17344703
GRCz11 16 17252680
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGGAAGACGAGTGGGAAGAGGAAGAGCAGATGGTTGTGGCTGAACTGT[C/A]AGGAATGATCAACTCTGACTTAATCTCCAATCGGCAAGGCACCTGCAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link