zgc:123177

Ensembl ID:
ENSDARG00000043287
ZFIN ID:
ZDB-GENE-051030-36
Description:
Autophagy-related protein 101 [Source:UniProtKB/Swiss-Prot;Acc:Q3B736]
Human Orthologue:
C12orf44
Human Description:
chromosome 12 open reading frame 44 [Source:HGNC Symbol;Acc:25679]
Mouse Orthologue:
9430023L20Rik
Mouse Description:
RIKEN cDNA 9430023L20 gene Gene [Source:MGI Symbol;Acc:MGI:1915368]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34938 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa34938
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063544 Nonsense 71 218 1 2
ENSDART00000125706 Nonsense 111 258 2 3
ENSDART00000126727 Nonsense 71 218 2 3
ENSDART00000141013 Nonsense 71 218 2 3
Genomic Location (Zv9):
Chromosome 10 (position 33615051)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 32716400
GRCz11 10 32660260
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGTGGACTGCGACTTCATAGACTTCACTTTCGTGCGAGTGTCTTCAGAC[G/T]AGCTGGACAGGGTCATCAGGAAAGCGGTGGCCGAGTTTAAGGTAATAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link