stap2b

Ensembl ID:
ENSDARG00000043281
ZFIN ID:
ZDB-GENE-040426-2540
Description:
signal transducing adaptor family member 2b [Source:RefSeq peptide;Acc:NP_998474]
Human Orthologue:
STAP2
Human Description:
signal transducing adaptor family member 2 [Source:HGNC Symbol;Acc:30430]
Mouse Orthologue:
Stap2
Mouse Description:
signal transducing adaptor family member 2 Gene [Source:MGI Symbol;Acc:MGI:2147039]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31642 Essential Splice Site Available for shipment Available now
sa13852 Nonsense Available for shipment Available now
sa15784 Nonsense Available for shipment Available now
sa34366 Essential Splice Site Mutation detected in F1 DNA During 2018
sa7128 Nonsense Mutation detected in F1 DNA During 2018
sa38682 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa31642
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100516 Essential Splice Site 56 410 3 15
Genomic Location (Zv9):
Chromosome 8 (position 19189019)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 18633907
GRCz11 8 18664572
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTGACAAGACAAGATTATTTATACATCAACTGTTTGCTTATGAATACA[G/A]TATATTGAGAAGCTGGAGCTGTCAGATCTCAACTCAGTGTCGGATGATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13852
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100516 Nonsense 141 410 5 15
Genomic Location (Zv9):
Chromosome 8 (position 19187477)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 18632365
GRCz11 8 18663030
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCTGGACAGATTCACGCAATGAAGGAAGTCATCGAAAAAGAGAAAACA[C/T]GACAACGGCTTCCTTCAGCTTCACCGCCAGAGCAGAACTTTGACCCCTAW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15784
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100516 Nonsense 157 410 5 15
Genomic Location (Zv9):
Chromosome 8 (position 19187427)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 18632315
GRCz11 8 18662980
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YGACAACGGCTTCCTTCAGCTTCACCGCCAGAGCAGAACTTTGACCCCTA[T/A]GTTTGCGTATTACCGGACATGCCTATGTAAGTTRAAACGACYTGATTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34366
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100516 Essential Splice Site 166 410 6 15
Genomic Location (Zv9):
Chromosome 8 (position 19185152)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 18630040
GRCz11 8 18660705
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCCATGCCTGTTATGTAATAATACAATAATAATGATGCATATTTAACA[G/T]GTGTTTTCATAAAGTGTCTCGTGTGGAAGCTGAAATTTTGTTGGAAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7128
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100516 Nonsense 266 410 8 15
Genomic Location (Zv9):
Chromosome 8 (position 19181607)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 18626495
GRCz11 8 18657160
KASP Assay ID:
554-4395.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGAGAAGACCRGTGGGGTTYTGGTGCCTTTCCATATGGAGAAACACTA[T/A]GATCAAGTTCTAGGTACGACTGTTTTGTATTTACTGTAAAGCAAATAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38682
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100516 Essential Splice Site 303 410 9 15
Genomic Location (Zv9):
Chromosome 8 (position 19178813)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 18623701
GRCz11 8 18654368
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCAAACCAGACGCTTCATCTACACCTCCAGTGCCCCCACCCAAACCTGG[T/G]AACACATCATCCTCATAGGCACACACACTGTTAATCAACGTATCTACCGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link