aqp12

Ensembl ID:
ENSDARG00000043279
ZFIN ID:
ZDB-GENE-040718-310
Description:
aquaporin-like [Source:RefSeq peptide;Acc:NP_001039327]
Human Orthologues:
AQP12A, AQP12B
Human Descriptions:
aquaporin 12A [Source:HGNC Symbol;Acc:19941]
aquaporin 12B [Source:HGNC Symbol;Acc:6096]
Mouse Orthologue:
Aqp12
Mouse Description:
aquaporin 12 Gene [Source:MGI Symbol;Acc:MGI:2664636]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32367 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32367
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063533 Nonsense 56 276 1 4
ENSDART00000082235 Nonsense 56 230 1 5
Genomic Location (Zv9):
Chromosome 22 (position 2129347)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2870437
GRCz11 22 2886703
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTGCGCCTGCAGACTGGAGGTGGACACCATCGCAGAGGTGGGACAGT[G/A]GGCCGGAGCACTCGGGCCAGATGTTGCGGTCACAATGCTGTTCCTGTCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link