
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
gtf3c3
- Ensembl ID:
- ENSDARG00000043247
- ZFIN ID:
- ZDB-GENE-040914-80
- Description:
- Im:7136784 protein [Source:UniProtKB/TrEMBL;Acc:Q5BLI4]
- Human Orthologue:
- GTF3C3
- Human Description:
- general transcription factor IIIC, polypeptide 3, 102kDa [Source:HGNC Symbol;Acc:4666]
- Mouse Orthologue:
- Gtf3c3
- Mouse Description:
- general transcription factor IIIC, polypeptide 3 Gene [Source:MGI Symbol;Acc:MGI:2138383]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa25515 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa32582 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa25515
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000127329 | Nonsense | 9 | 334 | 1 | 7 |
- Genomic Location (Zv9):
- Chromosome 1 (position 5125580)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 5564042 GRCz11 1 6261472 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GACTCTCTTGCTTTCTCAAGGACGGATGGATGATTACATTGATACAGTAT[T/A]GACCATGCTGTCCATGTTTCTTAAGGTCAGAACACGTGATATAAATGCAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32582
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000127329 | Nonsense | 329 | 334 | 7 | 7 |
- Genomic Location (Zv9):
- Chromosome 1 (position 5135977)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 5574439 GRCz11 1 6272050 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTTATTTACCAGTCCAGTGGTAATAAGGACATGGCCCGACACATCATCTA[T/A]ACTTACTGTACTATATGATCCTGTGATCCCATCTAATGTTGCTTTTGTAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: