znf609

Ensembl ID:
ENSDARG00000043246
ZFIN IDs:
ZDB-GENE-030131-5095, ZDB-GENE-030131-5095
Description:
hypothetical protein LOC796180 [Source:RefSeq peptide;Acc:NP_001121742]
Human Orthologue:
ZNF609
Human Description:
zinc finger protein 609 [Source:HGNC Symbol;Acc:29003]
Mouse Orthologue:
Zfp609
Mouse Description:
zinc finger protein 609 Gene [Source:MGI Symbol;Acc:MGI:2674092]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2357 Essential Splice Site F2 line generated During 2018
sa7088 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa2357
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063488   None 1129 None 7
ENSDART00000098338 Essential Splice Site None 259 1 2
ENSDART00000123308   None 1377 None 8
Genomic Location (Zv9):
Chromosome 7 (position 55910339)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 53144171
GRCz11 7 53413823
KASP Assay ID:
554-2788.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTATGGAATGTACATAAGTATTCTCTGGATAGGGGTTTGCGTGCGGGG[T/C]AAGTGGCGCTTGGATTNAATGCATTTTCTTTTGTGTGTGTGTNNATAAGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7088
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063488   None 1129 None 7
ENSDART00000098338 Nonsense 187 259 2 2
ENSDART00000123308 Nonsense 187 1377 1 8
Genomic Location (Zv9):
Chromosome 7 (position 55891578)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 53162932
GRCz11 7 53432584
KASP Assay ID:
554-5093.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGACCAGTCGCAGTTGTGGCAATTGAAAAGGATATAGTGACAAGTGCT[C/T]AAGCATTTGGAAGCACACGCAACACAGCCTTTGACAATACACAGAACGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link