
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
znf609
- Ensembl ID:
- ENSDARG00000043246
- ZFIN IDs:
- ZDB-GENE-030131-5095, ZDB-GENE-030131-5095
- Description:
- hypothetical protein LOC796180 [Source:RefSeq peptide;Acc:NP_001121742]
- Human Orthologue:
- ZNF609
- Human Description:
- zinc finger protein 609 [Source:HGNC Symbol;Acc:29003]
- Mouse Orthologue:
- Zfp609
- Mouse Description:
- zinc finger protein 609 Gene [Source:MGI Symbol;Acc:MGI:2674092]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa2357 | Essential Splice Site | F2 line generated | During 2018 |
sa7088 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa2357
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000063488 | None | 1129 | None | 7 | |
ENSDART00000098338 | Essential Splice Site | None | 259 | 1 | 2 |
ENSDART00000123308 | None | 1377 | None | 8 |
- Genomic Location (Zv9):
- Chromosome 7 (position 55910339)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 53144171 GRCz11 7 53413823 - KASP Assay ID:
- 554-2788.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTCTATGGAATGTACATAAGTATTCTCTGGATAGGGGTTTGCGTGCGGGG[T/C]AAGTGGCGCTTGGATTNAATGCATTTTCTTTTGTGTGTGTGTNNATAAGTGTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa7088
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000063488 | None | 1129 | None | 7 | |
ENSDART00000098338 | Nonsense | 187 | 259 | 2 | 2 |
ENSDART00000123308 | Nonsense | 187 | 1377 | 1 | 8 |
- Genomic Location (Zv9):
- Chromosome 7 (position 55891578)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 53162932 GRCz11 7 53432584 - KASP Assay ID:
- 554-5093.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTGGACCAGTCGCAGTTGTGGCAATTGAAAAGGATATAGTGACAAGTGCT[C/T]AAGCATTTGGAAGCACACGCAACACAGCCTTTGACAATACACAGAACGCA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: