prkchb

Ensembl ID:
ENSDARG00000043243
ZFIN ID:
ZDB-GENE-041001-104
Description:
protein kinase C, eta, b [Source:RefSeq peptide;Acc:NP_001038271]
Human Orthologue:
PRKCH
Human Description:
protein kinase C, eta [Source:HGNC Symbol;Acc:9403]
Mouse Orthologue:
Prkch
Mouse Description:
protein kinase C, eta Gene [Source:MGI Symbol;Acc:MGI:97600]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29336 Nonsense Mutation detected in F1 DNA During 2018
sa43415 Essential Splice Site Mutation detected in F1 DNA During 2018
sa43414 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa29336
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063483 Nonsense 97 676 1 14
Genomic Location (Zv9):
Chromosome 20 (position 20481901)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 20510068
GRCz11 20 20409741
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCACAGCACTCGTTTAGGATACGACACGTTTGTGGCTAATTGCAGAATC[C/T]AGCTTAAGGAAATCACAACGACACCAGGCACAAAGCCAAAATTTGAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43415
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063483 Essential Splice Site 268 676 7 14
Genomic Location (Zv9):
Chromosome 20 (position 20463220)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 20491387
GRCz11 20 20391060
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATGTACATGAAAACACATGGACAAATCTGTTTTGTGTGTAATTATGCA[G/T]TTTGTAAGATGAACATCCACAAACGCTGTGAACAAAATGTCGCACCTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43414
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063483 Nonsense 277 676 7 14
Genomic Location (Zv9):
Chromosome 20 (position 20463191)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 20491358
GRCz11 20 20391031
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTTGTGTGTAATTATGCAGTTTGTAAGATGAACATCCACAAACGCTG[T/A]GAACAAAATGTCGCACCTAATTGTGGAGTGGACAATGCTGAGCTGGCCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link