si:dkey-222f2.1

Ensembl ID:
ENSDARG00000043242
ZFIN ID:
ZDB-GENE-050208-726
Description:
Novel protein similar to vertebrate keratin family [Source:UniProtKB/TrEMBL;Acc:A8E7D1]
Human Orthologues:
KRT7, KRT81, KRT82, KRT83, KRT84, KRT85, KRT86
Human Descriptions:
keratin 7 [Source:HGNC Symbol;Acc:6445]
keratin 81 [Source:HGNC Symbol;Acc:6458]
keratin 82 [Source:HGNC Symbol;Acc:6459]
keratin 83 [Source:HGNC Symbol;Acc:6460]
keratin 84 [Source:HGNC Symbol;Acc:6461]
keratin 85 [Source:HGNC Symbol;Acc:6462]
keratin 86 [Source:HGNC Symbol;Acc:6463]
Mouse Orthologues:
4732456N10Rik, 5430421N21Rik, Krt7, Krt81, Krt82, Krt83, Krt84, Krt86
Mouse Descriptions:
keratin 7 Gene [Source:MGI Symbol;Acc:MGI:96704]
keratin 81 Gene [Source:MGI Symbol;Acc:MGI:1928858]
keratin 82 Gene [Source:MGI Symbol;Acc:MGI:2149248]
keratin 83 Gene [Source:MGI Symbol;Acc:MGI:3665486]
keratin 84 Gene [Source:MGI Symbol;Acc:MGI:96700]
keratin 86 Gene [Source:MGI Symbol;Acc:MGI:109362]
RIKEN cDNA 4732456N10 gene Gene [Source:MGI Symbol;Acc:MGI:3045312]
RIKEN cDNA 5430421N21 gene Gene [Source:MGI Symbol;Acc:MGI:3690448]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3173 Essential Splice Site F2 line generated During 2018

Mutation Details

Allele Name:
sa3173
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063484 Essential Splice Site 274 438 6 9
Genomic Location (Zv9):
Chromosome 22 (position 5659912)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 5705979
GRCz11 22 5735825
KASP Assay ID:
554-2922.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACTACAGTAAATAGTGTCTGGCATATTGCATTGATTTATGGTTGGTYA[G/A]TTTGATCAGATGGCGTCTCAAGCCAATCAGTACAACGACGAGCTGCGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link