
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
arrb1
- Ensembl ID:
- ENSDARG00000043241
- ZFIN IDs:
- ZDB-GENE-060824-1, ZDB-GENE-060824-1
- Description:
- beta-arrestin-1 [Source:RefSeq peptide;Acc:NP_001153294]
- Human Orthologue:
- ARRB1
- Human Description:
- arrestin, beta 1 [Source:HGNC Symbol;Acc:711]
- Mouse Orthologue:
- Arrb1
- Mouse Description:
- arrestin, beta 1 Gene [Source:MGI Symbol;Acc:MGI:99473]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa42479 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa662 | Nonsense | F2 line generated | During 2018 |
sa11194 | Nonsense | Available for shipment | Available now |
sa42478 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa42479
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000123839 | Nonsense | 109 | 157 | 5 | 15 |
ENSDART00000129080 | Nonsense | 109 | 418 | 5 | 16 |
- Genomic Location (Zv9):
- Chromosome 15 (position 5284685)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 5419511 GRCz11 15 5413232 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGAGAAAAAGAGCCTGACACGTCTACAAGAGCGACTGATAAAGAAACTC[G/T]GAGAGCATGCCTACCCCTTCACCTTTGAGGTCAAACTACTCTCATTTATC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa662
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000123839 | Nonsense | 113 | 157 | 5 | 15 |
ENSDART00000129080 | Nonsense | 113 | 418 | 5 | 16 |
- Genomic Location (Zv9):
- Chromosome 15 (position 5284671)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 5419497 GRCz11 15 5413218 - KASP Assay ID:
- 554-0570.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTGACACGTCTACAAGAGCGACTGATAAAGAAACTCGGAGAGCATGCCTA[C/A]CCCTTCACCTTTGAGGTCAAACTACTCTCATTTATCTTCATTTAATGCCA
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Mutation Details
- Allele Name:
- sa11194
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000123839 | Nonsense | 130 | 157 | 6 | 15 |
ENSDART00000129080 | Nonsense | 130 | 418 | 6 | 16 |
- Genomic Location (Zv9):
- Chromosome 15 (position 5284030)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 5418856 GRCz11 15 5412577 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CAAATCTTTCCTCACAGATTCCTCCAAACTTACCCTGTTCTGTCACATTA[C/T]AACCAGGGCCAGAAGATACAGGAAAGGTATATTTCCTTTGAATAATAATW
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42478
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000123839 | None | 157 | 13 | 15 | |
ENSDART00000129080 | Essential Splice Site | 341 | 418 | None | 16 |
- Genomic Location (Zv9):
- Chromosome 15 (position 5269036)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 5403926 GRCz11 15 5397647 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTAGCATGTCTAGTGGATGCCTCACTGCCATGATTTATGTCTCCCTCTGC[A/T]GTGATGTTGCCGTCGAGCTCCCCTTTACATTAATGCATCCTAAACCATTG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Thiazide-induced adverse metabolic effects in hypertensive patients: Genome-wide association analyses suggest NELL1 influences adverse metabolic response to HCTZ in African Americans. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: