sox4b

Ensembl ID:
ENSDARG00000043235
ZFIN ID:
ZDB-GENE-040426-1274
Description:
SRY-box containing gene 4b [Source:RefSeq peptide;Acc:NP_957195]
Human Orthologue:
SOX4
Human Description:
SRY (sex determining region Y)-box 4 [Source:HGNC Symbol;Acc:11200]
Mouse Orthologue:
Sox4
Mouse Description:
SRY-box containing gene 4 Gene [Source:MGI Symbol;Acc:MGI:98366]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39071 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39071
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063476 Nonsense 155 342 1 1
Genomic Location (Zv9):
Chromosome 16 (position 21687)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 68825
GRCz11 16 68825
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGAGAAGCTGAGCATCTCCAAGCCGTCCTCCAAGAAAAGATCTGCGGGG[A/T]AACCGCACAAGAAGGAGCCGGGACCCGCTGACCACCACTCGTTGTATAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bone mineral density: Genome-wide association study using extreme truncate selection identifies novel genes affecting bone mineral density and fracture risk. (View Study)
  • Cardiac hypertrophy: Hypertrophy-associated polymorphisms ascertained in a founder cohort applied to heart failure risk and mortality. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link