
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
adam17a
- Ensembl ID:
- ENSDARG00000043213
- ZFIN ID:
- ZDB-GENE-030131-2862
- Description:
- a disintegrin and metalloproteinase domain 17a [Source:RefSeq peptide;Acc:NP_955967]
- Human Orthologue:
- ADAM17
- Human Description:
- ADAM metallopeptidase domain 17 [Source:HGNC Symbol;Acc:195]
- Mouse Orthologue:
- Adam17
- Mouse Description:
- a disintegrin and metallopeptidase domain 17 Gene [Source:MGI Symbol;Acc:MGI:1096335]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa42975 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa15007 | Nonsense | Available for shipment | Available now |
sa17758 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa42975
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000063437 | Nonsense | 263 | 842 | 7 | 19 |
- Genomic Location (Zv9):
- Chromosome 17 (position 35438528)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 35323452 GRCz11 17 35271398 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATGAATTGCTAAATATTTATTGAATTGATGTGTTTTGTGTTGTTTAGATC[G/T]AGCTGATAGACAGAGTGGATGATATCTACAGGAACACATCCTGGGATGAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15007
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000063437 | Nonsense | 295 | 842 | 8 | 19 |
- Genomic Location (Zv9):
- Chromosome 17 (position 35437218)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 35322142 GRCz11 17 35270088 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATCTATGAATGTTATCTAATATGTAAATATSCCCACAGATAATCATAAAC[A/T]AGGATCCCACAAAAGTTGCCCCTGGAGAGTTTCACTACAACATGGATGGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa17758
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000063437 | Nonsense | 388 | 842 | 10 | 19 |
- Genomic Location (Zv9):
- Chromosome 17 (position 35433959)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 35318883 GRCz11 17 35266829 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CWTYACCTTGCAGCCTACTATCCATCACAGTCTGTCAAGAAACCCAGTTA[T/A]CTAAACACCGGCTTGACGAGCACCATGAACTATGGGAAAAYCATTCTGAC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: