
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ripk4
- Ensembl ID:
- ENSDARG00000043211
- ZFIN ID:
- ZDB-GENE-040426-2042
- Description:
- receptor-interacting serine/threonine-protein kinase 4 [Source:RefSeq peptide;Acc:NP_998243]
- Human Orthologue:
- RIPK4
- Human Description:
- receptor-interacting serine-threonine kinase 4 [Source:HGNC Symbol;Acc:496]
- Mouse Orthologue:
- Ripk4
- Mouse Description:
- receptor-interacting serine-threonine kinase 4 Gene [Source:MGI Symbol;Acc:MGI:1919638]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa5831 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa5831
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000063434 | Essential Splice Site | 224 | 820 | 4 | 8 |
ENSDART00000128181 | Essential Splice Site | 239 | 835 | 5 | 9 |
ENSDART00000131291 | Essential Splice Site | 196 | 792 | 4 | 8 |
- Genomic Location (Zv9):
- Chromosome 10 (position 36151630)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 35184332 GRCz11 10 35128192 - KASP Assay ID:
- 554-3728.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTTCTCCATTGTTATCTGGGGAATTCTCACACAGAAGAAGCCATATCAAG[G/A]TAAGAGGAGAAATAAAAGTGAAAAGATTAAAAGYGAAAGTATGTGTAGAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: