
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
mllt1
- Ensembl ID:
- ENSDARG00000043185
- ZFIN ID:
- ZDB-GENE-081105-45
- Description:
- Novel protein similar to human myeloid/lymphoid protein family [Source:UniProtKB/TrEMBL;Acc:B0S7E6]
- Human Orthologue:
- MLLT1
- Human Description:
- myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1 [Sour
- Mouse Orthologue:
- Mllt1
- Mouse Description:
- myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1 Gene
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa11638 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa11638
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000063400 | Essential Splice Site | 182 | 582 | 5 | 12 |
ENSDART00000141113 | Essential Splice Site | 178 | 575 | 4 | 11 |
- Genomic Location (Zv9):
- Chromosome 8 (position 20750521)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 20180418 GRCz11 8 20212503 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTCTGCCTTTTCAGACCCCAAGAAGAGCAAGACCTCACAAGGATCAAAGG[T/A]CAGTAAAAGGAGAAATAAGCCATTCTCAGTCWGAATGATACTCTTTTTAT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: