zgc:92745

Ensembl ID:
ENSDARG00000043173
ZFIN ID:
ZDB-GENE-040801-12
Description:
hypothetical protein LOC445032 [Source:RefSeq peptide;Acc:NP_001003426]
Human Orthologue:
CELA1
Human Description:
chymotrypsin-like elastase family, member 1 [Source:HGNC Symbol;Acc:3308]
Mouse Orthologue:
Cela1
Mouse Description:
chymotrypsin-like elastase family, member 1 Gene [Source:MGI Symbol;Acc:MGI:95314]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12828 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12828
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034545 Essential Splice Site 120 267 4 8
Genomic Location (Zv9):
Chromosome 22 (position 7520277)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 7452554
GRCz11 22 7482400
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCGTGCTCATATCCACCCCAACTGGAACAGCAACAGTTTGTCWTCTGG[G/T]TGTGTAAACATACATTACTCTGGCAGYGGTTGACTCTTTATAAACCCTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link