slc1a3b

Ensembl ID:
ENSDARG00000043148
ZFIN ID:
ZDB-GENE-090708-3
Description:
solute carrier family 1 (glial high affinity glutamate transporter), member 3b [Source:RefSeq pepti
Human Orthologue:
SLC1A3
Human Description:
solute carrier family 1 (glial high affinity glutamate transporter), member 3 [Source:HGNC Symbol;Ac
Mouse Orthologue:
Slc1a3
Mouse Description:
solute carrier family 1 (glial high affinity glutamate transporter), member 3 Gene [Source:MGI Symbo

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34953 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34953
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063347 Nonsense 398 537 7 9
ENSDART00000131693 Nonsense 398 537 8 10
Genomic Location (Zv9):
Chromosome 10 (position 37816063)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 36628224
GRCz11 10 36571982
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTTCTTCCTGTTGGAGCCACCATCAACATGGACGGAACAGCTCTGTA[T/A]GAAGCCCTGGCAGCCATCTTTATCGCCCAGGTGAACAACATGGAAATGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link