NP_001108566.1

Ensembl ID:
ENSDARG00000043130
Description:
notch homolog 2 [Source:RefSeq peptide;Acc:NP_001108566]
Human Orthologues:
NOTCH2, NOTCH2NL, RP11-458D21.5
Human Descriptions:
notch 2 N-terminal like [Source:HGNC Symbol;Acc:31862]
notch 2 [Source:HGNC Symbol;Acc:7882]
Mouse Orthologue:
Notch2
Mouse Description:
Notch gene homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:97364]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31643 Nonsense Available for shipment Available now
sa34370 Nonsense Mutation detected in F1 DNA During 2018
sa7129 Essential Splice Site Mutation detected in F1 DNA During 2018
sa25391 Nonsense Mutation detected in F1 DNA During 2018
sa41176 Essential Splice Site Mutation detected in F1 DNA During 2018
sa34371 Nonsense Mutation detected in F1 DNA During 2018
sa41177 Essential Splice Site Mutation detected in F1 DNA During 2018
sa38684 Splice Site, Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa31643
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032967 Nonsense 516 2475 9 35
ENSDART00000123474   None 828 None 11
ENSDART00000125246   None 826 None 10

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 20131434)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 19561331
GRCz11 8 19593416
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTCAGCTCACCTTGTCTTAATAACGGTAGATGTCTAGACCAGGTCAGC[C/T]GATTCGTCTGCGAGTGTCCTCAGGGTCAGTATAATGATTGGTGCAGTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34370
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032967 Nonsense 667 2475 12 35
ENSDART00000123474   None 828 None 11
ENSDART00000125246   None 826 None 10

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 20134590)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 19564487
GRCz11 8 19596572
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCAGTAATCCCTGCCAGCACGGGACCTGTGAGGATGGAATCAATGAGTA[C/A]AAATGCGTGTGCGAACCTGGATACACAGGTTTGTTCATCCCACATGCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7129
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032967 Essential Splice Site 790 2475 None 35
ENSDART00000123474   None 828 None 11
ENSDART00000125246   None 826 None 10

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 20137043)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 19566940
GRCz11 8 19599025
KASP Assay ID:
554-4892.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGACCGTCTGAATGATTAYACCTGCKTATGCGCCCGTGGGTTTGCAGG[T/G]AATGGCATGTGATCCTTTCTAAACAAAGTAACAAAGACATTTAGKTCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25391
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032967 Nonsense 800 2475 15 35
ENSDART00000123474   None 828 None 11
ENSDART00000125246   None 826 None 10

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 20137160)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 19567057
GRCz11 8 19599142
KASP Assay ID:
554-7785.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCCTTTCTTTCATTCAGGTTTCAACTGTGAGATCAACATAAATGAATG[T/A]GAGTCAAACCCCTGCATGAATCAGGGAACCTGTGTGGATGGAGTCAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41176
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032967 Essential Splice Site 868 2475 None 35
ENSDART00000123474   None 828 None 11
ENSDART00000125246   None 826 None 10

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 20138965)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 19568862
GRCz11 8 19600947
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGCTGGATTACACCAGCTACACCTGCAAATGCCACAGCGGCTGGGAGGG[T/C]GAGCGCTTCAAGTCTGGGTGTTGGTGTGATTACATATTTAAGTCAGTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34371
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032967 Nonsense 909 2475 17 35
ENSDART00000123474   None 828 None 11
ENSDART00000125246   None 826 None 10

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 20139336)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 19569233
GRCz11 8 19601318
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGGCAGCTACCGTTGCGAATGCCCGCCTGGATACAGCGGGGACAACTG[C/A]CAGACCAACATCGATGACTGCAGCTCTAGTACGTGTCTTTCCCACACCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41177
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032967 Essential Splice Site 1114 2475 None 35
ENSDART00000123474   None 828 None 11
ENSDART00000125246   None 826 None 10

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 20140982)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 19570879
GRCz11 8 19602964
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTGTGACATCCCCAGCATGTCCTGCCACGCTGTTGCCCTCAACAAAGG[T/A]AATACATTAGACATCTTCAGTGTAATTCCTTTGGAAGATATTTTATGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38684
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032967 Splice Site, Nonsense 1508 2475 25 35
ENSDART00000123474   None 828 None 11
ENSDART00000125246   None 826 None 10

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 20146644)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 19576541
GRCz11 8 19608626
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCTATTCGACAGCTTTGAATGCGACAAACATTCATCGGTGGGAATTTG[C/A]AAGTATGTTTACCAGTGTATTTTAATACTTTAGCACCTCACTTCTCTCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Type 2 diabetes: Meta-analysis of genome-wide association data and large-scale replication identifies additional susceptibility loci for type 2 diabetes. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link