wu:fj63d09

Ensembl ID:
ENSDARG00000043122
ZFIN ID:
ZDB-GENE-030131-8265
Human Orthologue:
GPR88
Human Description:
G protein-coupled receptor 88 [Source:HGNC Symbol;Acc:4539]
Mouse Orthologue:
Gpr88
Mouse Description:
G-protein coupled receptor 88 Gene [Source:MGI Symbol;Acc:MGI:1927653]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45765 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45765
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063313 Nonsense 111 274 1 2
Genomic Location (Zv9):
Chromosome 22 (position 16401077)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16159699
GRCz11 22 16185969
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTATTGCGGTCAACAGGTATGTTCTGATCACTAAAACGCCTGCTGTGTA[T/G]CAAAGTCTCTACCAGAAGAGAAACACCGAATGGATGATCGCAGGATCCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link