zgc:110354

Ensembl ID:
ENSDARG00000043093
ZFIN ID:
ZDB-GENE-050522-305
Description:
hypothetical protein LOC553612 [Source:RefSeq peptide;Acc:NP_001018422]
Human Orthologue:
MPEG1
Human Description:
macrophage expressed 1 [Source:HGNC Symbol;Acc:29619]
Mouse Orthologues:
Mpeg1, Pfpl
Mouse Descriptions:
macrophage expressed gene 1 Gene [Source:MGI Symbol;Acc:MGI:1333743]
pore forming protein-like Gene [Source:MGI Symbol;Acc:MGI:1860266]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21256 Nonsense Available for shipment Available now
sa34368 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21256
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063272 Nonsense 221 713 2 2
Genomic Location (Zv9):
Chromosome 8 (position 19882869)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 19327507
GRCz11 8 19357924
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCGATGCCGGTGCCACTTTAGTGCAGGAGGACTATATAAAAAGGTCTTA[C/A]GTCTCTGACACTAATTCAGAGAGGTCTTCTGTCTCTGCATCCGCAGGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34368
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063272 Nonsense 278 713 2 2
Genomic Location (Zv9):
Chromosome 8 (position 19883039)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 19327677
GRCz11 8 19358094
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACCAGCAAAACATCACATACTCATTAGTTCAGAGCCACGGCGGGGCTT[T/A]ATTCTATCAAGGCATCACTATGCAGAAGTGGCAAGAGAGCACTCAAAATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link