zgc:136911

Ensembl ID:
ENSDARG00000043089
ZFIN ID:
ZDB-GENE-060623-19
Description:
hypothetical protein LOC724056 [Source:RefSeq peptide;Acc:NP_001038796]
Human Orthologue:
ALOX5
Human Description:
arachidonate 5-lipoxygenase [Source:HGNC Symbol;Acc:435]
Mouse Orthologue:
Alox5
Mouse Description:
arachidonate 5-lipoxygenase Gene [Source:MGI Symbol;Acc:MGI:87999]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22564 Nonsense Available for shipment Available now
sa22565 Essential Splice Site Available for shipment Available now
sa13446 Nonsense Available for shipment Available now
sa24971 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa22564
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063264 Nonsense 29 676 2 15
ENSDART00000140870 Nonsense 29 676 2 15
Genomic Location (Zv9):
Chromosome 15 (position 965695)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 1005998
GRCz11 15 966801
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAAGTGTTTGCTGGGACTCTGAACTACATCTACCTGACGCTGGTGGGC[A/T]AAGAGAGAAGCAGCGACCGAACTCTGCTGGACAAATCCTGGTTTGAACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22565
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063264 Essential Splice Site 144 676 5 15
ENSDART00000140870 Essential Splice Site 144 676 5 15
Genomic Location (Zv9):
Chromosome 15 (position 968109)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 1008412
GRCz11 15 969215
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGTTACAACAATAAATGTTCAGTCTGATAACTAAACTGTCTCTTTTGC[A/G]GGTGGAATGAGTGGAAATCTGGCTTCCTAATGTCCATAGATGCCAATAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13446
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063264 Nonsense 304 676 8 15
ENSDART00000140870 Nonsense 304 676 8 15
Genomic Location (Zv9):
Chromosome 15 (position 969841)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 1010144
GRCz11 15 970947
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATACTGGAGGACGTGCAACCCAATGACACAGACCCCAGCACCCAGCAGTR[T/A]TTGGCCRCCCCCTTCTGCCTGTTTTACAAGAAYGGACAAAATGAATTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24971
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063264 Nonsense 654 676 15 15
ENSDART00000140870 Nonsense 654 676 15 15
Genomic Location (Zv9):
Chromosome 15 (position 974923)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 1015226
GRCz11 15 976029
KASP Assay ID:
554-7867.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAGAATTTCCGCAAGAAATTAGTTGACGTCACTAAGACCATCAGGAGA[C/T]GAAATGAAACTCTGGAACTGCCCTACTGGTATCTGTGTCCAGACAGAATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link