abcg2a

Ensembl ID:
ENSDARG00000043037
ZFIN ID:
ZDB-GENE-050517-35
Description:
ATP-binding cassette transporter sub-family G member 2a [Source:RefSeq peptide;Acc:NP_001036240]
Human Orthologue:
ABCG2
Human Description:
ATP-binding cassette, sub-family G (WHITE), member 2 [Source:HGNC Symbol;Acc:74]
Mouse Orthologues:
Abcg2, Abcg3
Mouse Descriptions:
ATP-binding cassette, sub-family G (WHITE), member 2 Gene [Source:MGI Symbol;Acc:MGI:1347061]
ATP-binding cassette, sub-family G (WHITE), member 3 Gene [Source:MGI Symbol;Acc:MGI:1351624]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44064 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44064
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063180 Essential Splice Site 450 644 10 18
Genomic Location (Zv9):
Chromosome 23 (position 46094689)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 46087198
GRCz11 23 45929993
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTCTGTTTCAGCAGCTGAACTCTTCATCGCAGAGAGGAAACTGTTTGT[G/T]TAAGTTTTTCAAATACAATAAAAATGGAGGATTTTCACAAGGTTTAGTTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link