zgc:76869

Ensembl ID:
ENSDARG00000042997
ZFIN ID:
ZDB-GENE-040426-2097
Description:
5-azacytidine-induced protein 2 [Source:RefSeq peptide;Acc:NP_999898]
Human Orthologue:
AZI2
Human Description:
5-azacytidine induced 2 [Source:HGNC Symbol;Acc:24002]
Mouse Orthologue:
Azi2
Mouse Description:
5-azacytidine induced gene 2 Gene [Source:MGI Symbol;Acc:MGI:1351332]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22968 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22968
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063131 Essential Splice Site 73 327 1 7
Genomic Location (Zv9):
Chromosome 16 (position 58607573)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 55375339
GRCz11 16 55083486
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAGGAGAACGGCCTGCTGCGCCGCCGCGTCAAACAGCTGGAGGACAAG[G/A]TCAGTTCATCAGCATCACACAAACAGCAGCTACTGATGGGAGAAACTGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link