zgc:77499

Ensembl ID:
ENSDARG00000042996
ZFIN ID:
ZDB-GENE-040426-2626
Description:
COX assembly mitochondrial protein homolog [Source:RefSeq peptide;Acc:NP_998491]
Human Orthologue:
CMC1
Human Description:
COX assembly mitochondrial protein homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:28783]
Mouse Orthologue:
Cmc1
Mouse Description:
COX assembly mitochondrial protein homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1915149]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42838 Essential Splice Site Mutation detected in F1 DNA During 2018
sa42837 Essential Splice Site Mutation detected in F1 DNA During 2018
sa36282 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42838
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063129 Essential Splice Site 6 107 1 4
Genomic Location (Zv9):
Chromosome 16 (position 58776456)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 55090648
GRCz11 16 55122736
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATACTACATTATCATTACCTTCAGTGTACATGGATCCGCCTAAAGCAG[G/A]TAGAGGAAGACTTTCATTTCCGCCAGACTTGTTTGTTGTGAATGTGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42837
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063129 Essential Splice Site 68 107 3 4
Genomic Location (Zv9):
Chromosome 16 (position 58762364)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 55104740
GRCz11 16 55108756
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAAGTGTCGTGAGGAGAACGCGGCGCTGAAAGAGTGTTTGACGCAGCA[G/A]TGAGTTTCTCTCTTCTACATTCACACACTCATTATCATTTTCCCTCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36282
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063129 Nonsense 69 107 4 4
Genomic Location (Zv9):
Chromosome 16 (position 58760460)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 55106644
GRCz11 16 55106852
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACATTTTTTCTTCTTCTTTTTTATTGTTTTGTGTGTTCGGCTGCAGTTA[T/A]CGGGATCCGGTGTTCTTCGAGGAGTGTAAACAGGAATATCTGAAGGAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link