
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
cyp2j21
- Ensembl ID:
- ENSDARG00000042990
- ZFIN ID:
- ZDB-GENE-040120-1
- Description:
- cytochrome P450, family 2, subfamily J, polypeptide 21 [Source:RefSeq peptide;Acc:NP_958919]
- Human Orthologue:
- CYP2J2
- Human Description:
- cytochrome P450, family 2, subfamily J, polypeptide 2 [Source:HGNC Symbol;Acc:2634]
- Mouse Orthologues:
- Cyp2j11-ps, Cyp2j5, Cyp2j6, Cyp2j9
- Mouse Descriptions:
- cytochrome P450, family 2, subfamily j, polypeptide 11, pseudogene Pseudogene [Source:MGI Symbol;Acc
- cytochrome P450, family 2, subfamily j, polypeptide 5 Gene [Source:MGI Symbol;Acc:MGI:1270149]
- cytochrome P450, family 2, subfamily j, polypeptide 6 Gene [Source:MGI Symbol;Acc:MGI:1270148]
- cytochrome P450, family 2, subfamily j, polypeptide 9 Gene [Source:MGI Symbol;Acc:MGI:1921769]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa45698 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa23709 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa45698
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000063122 | Nonsense | 264 | 497 | 5 | 9 |
ENSDART00000134047 | Nonsense | 264 | 497 | 6 | 10 |
- Genomic Location (Zv9):
- Chromosome 20 (position 25620885)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 25692188 GRCz11 20 25591278 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGGGTGACTGACTTTGTTCGAGAGAAGGTGAATGAACACAGAGCGGATTA[T/A]GATCAATCAAGTCTTCGAGACTACATTGACTGCTTTCTAGCTGAGATGGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23709
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000063122 | Nonsense | 449 | 497 | 9 | 9 |
ENSDART00000134047 | Nonsense | 449 | 497 | 10 | 10 |
- Genomic Location (Zv9):
- Chromosome 20 (position 25622975)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 25694278 GRCz11 20 25593368 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTGTTGGATTGTTTGATTTTCAGGAAAGAGAGTGTGTCTTGGGGAGCAGT[T/A]GGCGAGGATGGAGCTCTTCCTCTTCTTCACCTCTGTGCTGCAGCGCTTCA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: