sypa

Ensembl ID:
ENSDARG00000042974
ZFIN ID:
ZDB-GENE-031104-2
Description:
synaptophysin [Source:RefSeq peptide;Acc:NP_001137449]
Human Orthologue:
SYP
Human Description:
synaptophysin [Source:HGNC Symbol;Acc:11506]
Mouse Orthologue:
Syp
Mouse Description:
synaptophysin Gene [Source:MGI Symbol;Acc:MGI:98467]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa372 Splice Site, Nonsense Available for shipment Available now
sa21278 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa372
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063096 Splice Site, Nonsense 28 294 2 6
Genomic Location (Zv9):
Chromosome 8 (position 23786560)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 22912378
GRCz11 8 22933617
KASP Assay ID:
554-0244.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTTCAGGGTGCTGAAAGTCCCATTGGGCTTCATCAAAATCTTAGAATG[G/A]GTAAGTAAAATATTGTGTCTCGTTGGATCTTAAATTAATATTATCCATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21278
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063096 Nonsense 281 294 6 6
Genomic Location (Zv9):
Chromosome 8 (position 23800158)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 22925976
GRCz11 8 22947215
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAGCCAGCAAGGCTACAATCAGGGTGGAGACTACGGCCAGGGCGGATA[T/A]GAACAGCAGGGGGCACCCACCTCCTTTTCCAACCAGATGTGAGGGAAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link