zgc:136605

Ensembl ID:
ENSDARG00000042972
ZFIN ID:
ZDB-GENE-060312-11
Description:
hypothetical protein LOC664695 [Source:RefSeq peptide;Acc:NP_001034924]
Human Orthologue:
PLP2
Human Description:
proteolipid protein 2 (colonic epithelium-enriched) [Source:HGNC Symbol;Acc:9087]
Mouse Orthologues:
Gm6169, Plp2
Mouse Descriptions:
predicted gene 6169 Pseudogene [Source:MGI Symbol;Acc:MGI:3646298]
proteolipid protein 2 Gene [Source:MGI Symbol;Acc:MGI:1298382]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2455 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa2455
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099911 Nonsense 134 140 5 6
ENSDART00000099911 Nonsense 134 140 5 6
Genomic Location (Zv9):
Chromosome 8 (position 23811809)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 22937627
GRCz11 8 22958866
KASP Assay ID:
554-3253.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGGATTTGACACCTTATGCATAATAAAACAAATCAAGGAACTGAATGAG[G/T]AATCTAGTAAGTAAAATCACTAACAGACCCCTTAACTGTCACCCTACATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link