Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
dgcr2
- Ensembl ID:
- ENSDARG00000042962
- ZFIN ID:
- ZDB-GENE-040718-404
- Description:
- DiGeorge syndrome critical region gene 2 [Source:RefSeq peptide;Acc:NP_001002656]
- Human Orthologue:
- DGCR2
- Human Description:
- DiGeorge syndrome critical region gene 2 [Source:HGNC Symbol;Acc:2845]
- Mouse Orthologue:
- Dgcr2
- Mouse Description:
- DiGeorge syndrome critical region gene 2 Gene [Source:MGI Symbol;Acc:MGI:892866]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa4393 | Nonsense | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa4393
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000063071 | Nonsense | 229 | 536 | 7 | 11 |
- Genomic Location (Zv9):
- Chromosome 10 (position 43425357)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 42231852 GRCz11 10 42060232 - KASP Assay ID:
- 554-3522.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GGTCTTGAAGCCCTCGGTGAAGCCAATCCCACCCAGGACAATGTTTTCTG[T/A]GCTCAGCTGCAGCGTTTCCAGATCAAGAGCATGAATGAGCRCGGTCTGCA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
