zgc:100920

Ensembl ID:
ENSDARG00000042961
ZFIN ID:
ZDB-GENE-040801-156
Description:
hypothetical protein LOC445241 [Source:RefSeq peptide;Acc:NP_001003635]
Human Orthologues:
NKAIN1, NKAIN2, NKAIN3, NKAIN4
Human Descriptions:
Na+/K+ transporting ATPase interacting 1 [Source:HGNC Symbol;Acc:25743]
Na+/K+ transporting ATPase interacting 2 [Source:HGNC Symbol;Acc:16443]
Na+/K+ transporting ATPase interacting 3 [Source:HGNC Symbol;Acc:26829]
Na+/K+ transporting ATPase interacting 4 [Source:HGNC Symbol;Acc:16191]
Mouse Orthologues:
Nkain1, Nkain2, Nkain2, Nkain3, Nkain4
Mouse Descriptions:
Na+/K+ transporting ATPase interacting 1 Gene [Source:MGI Symbol;Acc:MGI:1914399]
Na+/K+ transporting ATPase interacting 2 Gene [Source:MGI Symbol;Acc:MGI:1923447]
Na+/K+ transporting ATPase interacting 2 Gene [Source:MGI Symbol;Acc:MGI:1923447]
Na+/K+ transporting ATPase interacting 3 Gene [Source:MGI Symbol;Acc:MGI:2444830]
Na+/K+ transporting ATPase interacting 4 Gene [Source:MGI Symbol;Acc:MGI:1915372]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15307 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15307
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063075 Nonsense 124 181 4 6
Genomic Location (Zv9):
Chromosome 8 (position 23954427)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23080245
GRCz11 8 23101484
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGGMCAACGGTCCAGGCTGTGAGAACARAAACCYCCAGACCACTAGAT[G/A]GCAGCATCTGGACAGTCCTGCGCTGGTCACTGACATGAGCTGCATGTTAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link