slc25a27

Ensembl ID:
ENSDARG00000042873
ZFIN ID:
ZDB-GENE-040426-1290
Description:
mitochondrial uncoupling protein 4 [Source:RefSeq peptide;Acc:NP_956635]
Human Orthologue:
SLC25A27
Human Description:
solute carrier family 25, member 27 [Source:HGNC Symbol;Acc:21065]
Mouse Orthologue:
Slc25a27
Mouse Description:
solute carrier family 25, member 27 Gene [Source:MGI Symbol;Acc:MGI:1921261]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18343 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18343
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062925 Nonsense 203 315 6 9
Genomic Location (Zv9):
Chromosome 20 (position 36827156)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 36899669
GRCz11 20 36802548
KASP Assay ID:
2261-4720.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAAAATCAACCTTTTCATCTTGATTTAATSTTTAGATCTCATGACGTA[C/A]GATACAGTGAAGCATTTTCWGCTGAGAAACACCTCCATACCGGACAACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link