zdhhc8a

Ensembl ID:
ENSDARG00000042872
ZFIN ID:
ZDB-GENE-091118-26
Human Orthologue:
ANKLE2
Human Description:
ankyrin repeat and LEM domain containing 2 [Source:HGNC Symbol;Acc:29101]
Mouse Orthologue:
Ankle2
Mouse Description:
ankyrin repeat and LEM domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1261856]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17483 Nonsense Available for shipment Available now
sa45384 Nonsense Mutation detected in F1 DNA During 2018
sa21626 Essential Splice Site Mutation detected in F1 DNA During 2018
sa21627 Essential Splice Site, Missense Available for shipment Available now

Mutation Details

Allele Name:
sa17483
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062927 Nonsense 74 682 1 12
ENSDART00000063671   None 634 None 13
ENSDART00000135598   None 259 None 2
ENSDART00000140715   None 217 None 6
ENSDART00000147740   None 239 None 6
Genomic Location (Zv9):
Chromosome 10 (position 428913)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 425686
GRCz11 10 427331
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCAAGTGGAGCACTTCCTGCGGAMGAGCCCGAGCAGCCAATCAGTGTG[C/T]AGGAGACACAGGAAGYGAGRGAGGAGAGCNNNNNNNNNTCCACTGAGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45384
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062927 Nonsense 77 682 1 12
ENSDART00000063671   None 634 None 13
ENSDART00000135598   None 259 None 2
ENSDART00000140715   None 217 None 6
ENSDART00000147740   None 239 None 6
Genomic Location (Zv9):
Chromosome 10 (position 428922)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 425695
GRCz11 10 427340
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCACTTCCTGCGGACGAGCCCGAGCAGCCAATCAGTGTGCAGGAGACA[C/T]AGGAAGCGAGGGAGGAGAGCTCAGAGACGTCCACTGAGGGGCCGAGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21626
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062927   None 682 None 12
ENSDART00000063671 Essential Splice Site 407 634 11 13
ENSDART00000135598   None 259 None 2
ENSDART00000140715   None 217 None 6
ENSDART00000147740   None 239 None 6
Genomic Location (Zv9):
Chromosome 10 (position 453150)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 449923
GRCz11 10 451568
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAAACAACACTAACGCACTAGGTCTTGACACATTTTGGTTTTGTGATG[T/G]TACTATTTAAAACTATTTACCATGAGGTAAGTCATTTTACTCAGGAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21627
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062927   None 682 None 12
ENSDART00000063671 Essential Splice Site 408 634 None 13
ENSDART00000135598 Missense 11 259 1 2
ENSDART00000140715   None 217 None 6
ENSDART00000147740   None 239 None 6
Genomic Location (Zv9):
Chromosome 10 (position 455232)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 452005
GRCz11 10 453650
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTGTCTGTTGTTTATAGATGGGGATGAGGATATCTCCTCTACTCTCTC[A/T]GGAACATGCGTCTGAGCCCAGTCTGCTCCAGTCGGACAACCACATGTCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link