si:dkey-5g7.3

Ensembl ID:
ENSDARG00000042859
ZFIN ID:
ZDB-GENE-041001-177
Description:
hypothetical protein LOC563356 [Source:RefSeq peptide;Acc:NP_001020700]
Human Orthologue:
SLC5A6
Human Description:
solute carrier family 5 (sodium-dependent vitamin transporter), member 6 [Source:HGNC Symbol;Acc:110
Mouse Orthologue:
Slc5a6
Mouse Description:
solute carrier family 5 (sodium-dependent vitamin transporter), member 6 Gene [Source:MGI Symbol;Acc

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11584 Nonsense Available for shipment Available now
sa537 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11584
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062904 Nonsense 230 619 7 16
ENSDART00000134819 Nonsense 236 625 6 15
Genomic Location (Zv9):
Chromosome 20 (position 36679101)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 36751614
GRCz11 20 36654493
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTCATTCATTGTTTTGTTGACCGCATGGCAGTCTGAACCCTGACCCTT[T/A]AGAGAGGCACACTTTCTGGACCCTAGGAGTTGGAGGTGTTTTTCTCATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa537
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062904 Essential Splice Site 314 619 8 16
ENSDART00000134819 Essential Splice Site 320 625 7 15
Genomic Location (Zv9):
Chromosome 20 (position 36678658)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 36751171
GRCz11 20 36654050
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGGGAGGAAAGCCCTCTGGATCAGGGCTACGTTACAACTAATGATCAG[G/A]TCAGAAACAAATAAAAATATGGTAACACTTCAGTTTAAGTCACAATTCTA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link